Genetics: principles and analysis
Gespeichert in:
| Hauptverfasser: | , |
|---|---|
| Format: | Buch |
| Sprache: | English |
| Veröffentlicht: |
Sudbury, Mass. [u.a.]
Jones and Bartlett
1998
|
| Ausgabe: | 4. ed. |
| Schlagworte: | |
| Online-Zugang: | Inhaltsverzeichnis |
| Beschreibung: | XXIII, 840 S. Ill., graph. Darst. |
| ISBN: | 076370489X |
Internformat
MARC
| LEADER | 00000nam a2200000zc 4500 | ||
|---|---|---|---|
| 001 | BV023776500 | ||
| 003 | DE-604 | ||
| 005 | 20070313000000.0 | ||
| 007 | t | ||
| 008 | 990715s1998 ad|| |||| 00||| eng d | ||
| 020 | |a 076370489X |9 0-7637-0489-X | ||
| 035 | |a (OCoLC)611135656 | ||
| 035 | |a (DE-599)BVBBV023776500 | ||
| 040 | |a DE-604 |b ger | ||
| 041 | 0 | |a eng | |
| 049 | |a DE-634 |a DE-11 | ||
| 082 | 0 | |a 576.5 | |
| 084 | |a WG 1000 |0 (DE-625)148483: |2 rvk | ||
| 100 | 1 | |a Hartl, Daniel L. |e Verfasser |4 aut | |
| 245 | 1 | 0 | |a Genetics |b principles and analysis |c Daniel L. Hartl ; Elizabeth W. Jones |
| 250 | |a 4. ed. | ||
| 264 | 1 | |a Sudbury, Mass. [u.a.] |b Jones and Bartlett |c 1998 | |
| 300 | |a XXIII, 840 S. |b Ill., graph. Darst. | ||
| 336 | |b txt |2 rdacontent | ||
| 337 | |b n |2 rdamedia | ||
| 338 | |b nc |2 rdacarrier | ||
| 650 | 0 | 7 | |a Genetik |0 (DE-588)4071711-2 |2 gnd |9 rswk-swf |
| 689 | 0 | 0 | |a Genetik |0 (DE-588)4071711-2 |D s |
| 689 | 0 | |5 DE-604 | |
| 700 | 1 | |a Jones, Elizabeth W. |e Verfasser |4 aut | |
| 856 | 4 | 2 | |m HEBIS Datenaustausch |q application/pdf |u http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&local_base=BVB01&doc_number=017418714&sequence=000002&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA |3 Inhaltsverzeichnis |
| 999 | |a oai:aleph.bib-bvb.de:BVB01-017418714 | ||
Datensatz im Suchindex
| _version_ | 1804138966186721280 |
|---|---|
| adam_text | GENETICS
Principles and Analysis
Fourth Edition
DANIELLHARTL
Harvard University
ELIZABETHWJO
Carnegie Mellon University
N E S
Jones and Bartlett Publishers
Sudbury, Massachusetts
BOSTON TORONTO LONDON SINGAPORE
BRIEF CONTENTS
Chapter 1 The Molecular Basis of Heredity and Variation 1
Chapter 2 Principles of Genetic Transmission 30
Chapter 3 Genes and Chromosomes 80
Chapter 4 Genetic Linkage and Chromosome Mapping 122
Chapter 5 The Molecular Structure and Replication of the Genetic Material 172
Chapter 6 The Molecular Organization of Chromosomes 220
•
Chapter 7 Variation in Chromosome Number and Structure 258
Chapter 8 The Genetics of Bacteria and Viruses 306
Chapter 9 Genetic Engineering and Genome Analysis 358
Chapter 10 Gene Expression 410
Chapter 11 Regulation of Gene Activity 458
Chapter 12 The Genetic Control of Development 510
Chapter 13 Mutation, DNA Repair, and Recombination 554
Chapter 14 Extranuclear Inheritance 598
Chapter 15 Population Genetics and Evolution 626
Chapter 16 Quantitative Genetics and Multifactorial Inheritance 668
Chapter 17 Genetics of Biorhythms and Behavior 702
iii
CONTENTS
Preface xv
Introduction: Forthe Student XXI
CHAPTER1
The Molecular Basis of Heredity and Variation 1
1-1
1-2
1-3
1-4
1-5
1-6
1-7
DNA: The Genetic Material 2
Experimental Proof of the Genetic Function of DNA 3
Genetic Role of DNA in Bacteriophage 6
DNA Structure: The Double Helix 9
An Overview of DNA Replication 10
Genes and Proteins 12
Transcription of DNA Makes RNA 12
Translation of RNA Makes Protein 14
Mutation 15
How Genes Determine Traits 16
Pleiotropy: One Gene Can Affect More Than One Trait
Epistasis: One Trait Can Be Affected by More Than
One Gene 19
Effects of the Environment 20
Evolution 22
The Molecular Continuity of Life 22
Adaptation and Diversity 23
The Role of Chance in Evolution 24
CHAPTERENDMATERIAL
Chapter Summary 24
Key Terms 25
Review the Basics 26
Guide to Problem Solving 26
Analysis and Applications 28
Further Reading 29
SPECIALFEATURES
CONNECTION: It s the DNA! 4
Oswald T Avery, Colin M MacLeod,
and Maclvn McCariy 1944
Studies on the chemical nature of the substance inducing trans
formation of pneumococcal types
CONNECTION: Shear Madness 8
Alfred D Hershey and Martha Chase 1952
Independent functions of viral protein and nucleic acid in growth
of bacteriophage
GeNETics on the web 27
CHAPTER2
Principles of Genetic Transmission 30
2-1
2-2
2-3
2-4
2-5
2-6
2-7
The Monohybrid Crosses 32
Traits Present in the Progeny of the Hybrids 35
Mendel s Genetic Hypothesis and Its Experimental Tests 36
The Principle of Segregation 40
Important Genetic Terminology 40
Verification of Mendelian Segregation by the Testcross 41
Segregation of Two or More Genes 42
The Principle of Independent Assortment 42
Dihybrid Testcrosses 45
The Big Experiment 45
Mendelian Inheritance and Probability 48
Mutually Exclusive Events: The Addition Rule 48
Independent Events: The Multiplication Rule 49
Segregation in Human Pedigrees 51
Genetic Analysis 54
The Complementation Test in Gene Identification 54
Why Does the Complementation Test Work? 58
Multiple Alleles 60
Modified Dihybrid Ratios Caused by Epistasis 61
Complications in the Concept of Dominance 64
Amorphs, Hypomorphs, and Other Types of Mutations 66
Incomplete Dominance 67
Codominance and the Human ABO Blood Groups 68
Incomplete Penetrance and Variable Expressivity 70
CHAPTERENDMATERIAL
Chapter Summary 72
Key Terms 73
Review the Basics 73
Guide to Problem Solving 73
Analysis and Applications 76
Challenge Problems 78
Further Reading 79
SPECIALFEATURES
CONNECTION: What Did Gregor Mendel Think He
Discovered? 38
Gregor Mendel 1866
Experiments on plant hybrids
CONNECTION: This Land Is Your Land, This Land Is My
Land 53
The Huntington s Disease Collaborative Research
Group 1993
A novel gene containing a trinucleotide repeat that is expanded
and unstable on Huntington s disease chromosome
GeNETics on the web 74
IV Contents
CHAPTER3
Genes and Chromosomes 80
3-1 The Stability of Chromosome Complements 82
3-2 Mitosis 83
3-3 Meiosis 87
The First Meiotic Division: Reduction 89
The Second Meiotic Division:
Equation 94
3-4 Chromosomes and Heredity 96
Chromosomal Determination of Sex 97
X-linked Inheritance 97
Nondisjunction as Proof of the Chromosome
Theory of Heredity 103
Sex Determination in Drosophila 104
3-5 Probability in Prediction and Analysis of
Genetic Data 106
Using the Binomial Distribution in
Genetics 106
Evaluating the Fit of Observed Results
to Theoretical Expectations 109
The Chi-square Method 109
3-6 Are Mendel s Data Too Good to Be True? 114
CHAPTERENDMATERIAL
Chapter Summary 115
Key Terms 116
Review the Basics 117
Guide to Problem Solving 117
Analysis and Applications 119
Challenge Problems 121
Further Reading 121
SPECIALFEATURES
CONNECTION: Grasshopper, Grasshopper 96
E Eleanor Carothers 1913
The Mendelian ratio in relation to certain Ortliopteran
chromosomes
CONNECTION: The White-Eyed Male
Thomas Hum Morgan 1910
Sex limited inheritance in Drosophila
CONNECTION: The Case Against
Mendel s Gardener 112
Ronald Aylmer Fisher 1936
Has Mendel s work been rediscovered?
GeNETics on the web 118
CHAPTER4
Genetic Linkageand Chromosome Mapping 122
4-1
4-2
4-3
4-4
4-5
4-6
4-7
4-8
Linkage and Recombination of Genes in a
Chromosome 124
Genetic Mapping 127
Crossing-over 132
Crossing-over Takes Place at the Four-Strand Stage
of Meiosis 134
The Molecular Basis of Crossing-over 137
Multiple Crossing-over 138
Gene Mapping from Three-Point Testcrosses 141
Chromosome Interference in Double
Crossing-over 143
Genetic Mapping Functions 144
Genetic Distance and Physical
Distance 145
Genetic Mapping in Human Pedigrees 146
Mapping by Tetrad Analysis 150
The Analysis of Unordered Tetrads 151
The Analysis of Ordered Tetrads
Mitotic Recombination 158
Recombination Within Genes 160
A Closer Look at Complementation
1 nonrecQRibiflani
CHAPTERENDMATERIAL
Chapter Summary 162
Key Terms 163
Review the Basics 164
Guide to Problem Solving 164
Analysis and Applications 167
Challenge Problems 170
Further Reading 171
SPECIALFEATURES
CONNECTION: Genes All in a ROW 131
Alfred H Sturtevant 1913
The linear arrangement of six sex-linked factors in Drosophila as
shown by their mode of association
CONNECTION: Dos XX 137
Lilian V Morgan 1922
Non-crisscross inheritance in Drosophila Mclanogasicr
GeNETics on the web 164
Contents
CHAPTER5
The Molecular Structure and Replication
of the Genetic Material 172
5-1 The Chemical Composition of DNA 174
5-2 The Physical Structure of the Double Helix 177
5-3 What a Genetic Material Needs That DNA Supplies 181
5-4 The Replication of DNA 182
The Basic Rule for the Replication of Nucleic Acids 182
The Geometry of DNA Replication 183
5-5 DNA Synthesis 191
5-6 Discontinuous Replication 194
Fragments in the Replication Fork 194
Initiation by an RNA Primer 195
The Joining of Precursor Fragments 196
Other Proteins Needed for DNA Replication 196
5-7 The Isolation and Characterization of Particular DNA Fragments
Denaturation and Renaturation 199
Nucleic Acid Hybridization 200
Restriction Enzymes and Site-Specific DNA Cleavage 202
Gel Electrophoresis 205
The Southern Blot 206
5-8 The Polymerase Chain Reaction 207
5-9 Determination of the Sequence of Bases in DNA 210
The Sequencing Procedure 212
Clinical Use of Dideoxynucleoside Analogs 213
CHAPTER6
The Molecular Organization of Chromosomes 220
6-1 Genome Size and Evolutionary Complexity 222
6-2 The Supercoiling of DNA 224
Topoisomerase Enzymes 225
6-3 The Structure of the Bacterial Chromosome 225
6-4 The Structure of Eukaryotic Chromosomes 228
The Nucleosome Is the Basic Structural Unit
of Chromatin 228
Nucleosome Core Particles 229
The Arrangement of Chromatin Fibers
in a Chromosome 230
6-5 Polytene Chromosomes 234
6-6 Repetitive Nucleotide Sequences in Eukaryotic Genomes 235
Kinetics of DNA Renaturation 236
Analysis of Genome Size and Repetitive Sequences by
Renaturation 238
6-7 Nucleotide Sequence Composition of Eukaryotic Genomes 239
Unique Sequences 240
Highly Repetitive Sequences 240
Middle-Repetitive Sequences 241
6-8 Transposable Elements 242
6-9 Centromere and Telomere Structure 246
Molecular Structure of the Centromere 246
Molecular Structure of the Telomere 247
CHAPTERENDMATERIAL
Chapter Summary 214
Key Terms 214
Review the Basics 215
Guide to Problems Solving 215
Analysis and Applications 216
Challenge Problems 218
Further Reading 219
SPECIALFEATURES
CONNECTION: The Double Helix 180
James D Watson and Francis H C Crick 1953
A structure for deoxyribose nucleic acid
CONNECTION: Replication by Halves 184
Matthew Meselson and Franklin W Stahl 1958
The replication of DNA in Escherichia coli
GeNETics on the web 217
CHAPTERENDMATERIAL
Chapter Summary 253
Key Terms 253
Review the Basics 254
Guide to Problem Solving 254
Analysis and Applications 255
Challenge Problem 256
Further Reading 257
SPECIALFEATURES
CONNECTION: Her Feeling for the Organism 245
Barbara McCiintock 1950
The origin and behavior of mutable loci in maize
CONNECTION: Telomeres: The Beginning of the End
Carol W Greider and Elizabeth H Blackburn 1987
The telomere terminal transferase o/Tetrahymena is a ribo-
nucleoprotein enzyme with two kinds of primer specificity
GeNETics on the web 256
vi Contents
CHAPTER7
Variation in Chromosome Number and Structure 258
7-1 Centromeres and the Genetic Stability of Chromosomes 260
7-2 Polyploidy 261
7-3 Monoploid Organisms 266
7-4 Extra or Missing Chromosomes 267
7-5 Human Chromosomes 269
Trisomy in Human Beings 274
Dosage Compensation 274
The Calico Cat as Evidence for X-Chromosome
Inactivation 277
Sex-Chromosome Abnormalities 278
The Fragile-X Syndrome 279
Chromosome Abnormalities in Spontaneous
Abortion 280
7-6 Abnormalities in Chromosome Structure 281
Deletions 281
Duplications 282
Unequal Crossing-Over in Human Red-Green Color Blindness
Inversions 286
Reciprocal Translocations 288
Robertsonian Translocations 293
7-7 Position Effects on Gene Expression 296
7-8 Chromosome Abnormalities and Cancer 297
Retinoblastoma and Tumor-Suppressor Genes 298
CHAPTERENDMATERIAL
Chapter Summary 300
Key Terms 300
Review the Basics 301
Guide to Problem Solving 301
Analysis and Applications 302
Challenge Problems 305
Further Reading 305
SPECIALFEATURES
CONNECTION: The First Human Chromosomal
Disorder 271
Jerome Lejeune Marihe Gautier, and
Raymond Turpin 1959
Study of the somatic chromosomes of nine Down syndrome
children
CONNECTION: Lyonization of an X Chromosome 276
Mary F Lyon 1961
Gene action in the X chromosome of the mouse
(Mus musculus L )
GeNETics on the web 303
CHAPTER8
The Genetics of Bacteria and Viruses 306
8-1 The Genetic Organization of Bacteria and
Viruses 308 ~
8-2 Bacterial Mutants 311
8-3 Bacterial Transformation 312
8-4 Conjugation 314
Plasmids 314
Hfr Cells 317
Time-of-Entry Mapping 319
F Plasmids 324
8-5 Transduction 325
8-6 Bacteriophage Genetics 329
Plaque Formation and Phage Mutants 330
Genetic Recombination in Virulent
Bacteriophages 331
Fine Structure of the rll Gene in
Bacteriophage T4 336
8-7 Genetic Recombination in Temperate
Bacteriophages 340
Lysogeny 340
Specialized Transducing Phage 345
8-8 Transposable Elements 346
Transposons in Genetic Analysis 349
CHAPTERENDMATERIAL
Chapter Summary 350
Key Terms 351
Review the Basics 352
Guide to Problem Solving 352
Analysis and Applications 353
Challenge Problems 356
Further Reading 357
SPECIALFEATURES
CONNECTION: The Sex Life of Bacteria 322
Joshua Lederberg and Edward L Tatum 1946
Gene recombination in Escherichia coli
CONNECTION: IS a Bacteriophage an Organism? 329
Alfred D Hershey and Raquel Rotman 1948
Genetic recombination between host-range and plaque-type
mutants of bacteriophage in single bacterial cells
CONNECTION: Artoo 334
Seymour Benzer 1955
Fine structure of a genetic region in bacteriophage
GeNETics on the web 354
Contents vii
CHAPTER9
Genetic Engineering and Genome Analysis 358
9-1
9-2
9-3
9-4
9-5
9-6
9-7
Restriction Enzymes and Vectors 360
Production of Defined DNA Fragments 360
Recombinant DNA Molecules 362
Plasmid, Lambda, Cosmid, and PI Vectors 365
Cloning Strategies 365
Joining DNA Fragments 366
Insertion of a Particular DNA Molecule into a Vector 366
The Use of Reverse Transcriptase: cDNA and RT-PCR 369
Detection of Recombinant Molecules 370
Screening for Particular Recombinants 372
Positional Cloning 372
Site-Directed Mutagenesis 374
Reverse Genetics 377
Germ-Line Transformation in Animals 377
Genetic Engineering in Plants 380
Applications of Genetic Engineering 382
Giant Salmon with Engineered Growth Hormone 382
Engineered Male Sterility with Suicide Genes 383
Other Commercial Opportunities 384
Uses in Research 386
Production of Useful Proteins 386
Genetic Engineering with Animal Viruses 387
Diagnosis of Hereditary Diseases 388
Analysis of Complex Genomes 388
Sizes of Complex Genomes 388
Manipulation of Large DNA Fragments 390
Cloning of Large DNA Fragments 390
Physical Mapping 392
The Genome of E coli 395
The Human-Genome 395
Genome Evolution in the Grass-Family 398
Large-Scale DNA Sequencing 400
Complete Sequence of the Yeast Genome 400
Automated DNA Sequencing 401
CHAPTERENDMATERIAL
Chapter Summary 405
Key Terms 406
Review the Basics 406
Guide to Problem Solving 406
Analysis and Applications 407
Challenge Problems 409
Further Reading 409
SPECIALFEATURES
CONNECTION: Hello, Dolly! 380
Ian Wilmut Anagelika E Schnieke, Jim McWhir Alex J
Kind, and Keith H S Campbell 1997
Viable offspring derived from fetal and adult mammalian cells
CONNECTION: YAC-ityYAC 393
David T Burke Georges F Carle and Maynard V
Olson 1987
Cloning of large segments of exogenous DNA into yeast by means
of artificial chromosome vectors
GeNETics on the web 408
CHAPTER10
Gene Expression 410
10-1
10-2
10-3
10-4
10-5
Proteins and Amino Acids 412
Relations Between Genes and Polypeptides 415
What Are the Minimal Genetic Functions Needed for Life?
Transcription 418
General Features of RNA Synthesis 418
Messenger RNA 423
RNA Processing 424
Termination 436
Monocistronic and Polycistronic mRNA 436
Translation 430
Initiation 431
Elongation 433
Termination 436
Monocistronic and Polycistronic mRNA 436
CHAPTERENDMATERIAL
Chapter Summary 452
Key Terms 453
Review the Basics 453
Guide to Problem Solving 453
Analysis and Applications 455
Challenge Problems 457
Further Reading 457
VIII Contents
10-6 The Genetic Code 438
Genetic Evidence for a Triplet Code 439
Elucidation of the Base Sequences of the
Codons 442
A Summary of the Code 443
Transfer RNA and Aminoacyl-tRNA Synthetase
Enzymes 444
Redundancy and Wobble 445
Nonsense Suppression 447
The Sequence Organization of a Typical Prokaryotic
mRNA Molecule 449
10-7 Overlapping Genes 449
10-8 Complex Translation Units 450
10-9 The Overall Process of Gene
Expression 451
SPECIALFEATURES
CONNECTION: One Gene, One Enzyme 420
George W Beadle and Edward L Tatum 1941
Genetic control of biochemical reactions in Neurospora
CONNECTION: Messenger Light 439
Sydney Brenner Francois Jacob and Matthew Meselson
All unstable intermediate carrying information from genes to ribo-
somesfor protein synthesis
CONNECTION: Uncles and Aunts 442
Francis H C Crick, Leslie Barnett Sydney Brenner, and R
J Watis-Tobin 1961
General nature of the genetic code for proteins
GeNETics on the web 454
CHAPTER11
Regulation of Gene Activity 458
11-1 Transcriptional Regulation in Prokaryotes 460
11 -2 Lactose Metabolism and the Operon 462
Lac Mutants 462
Inducible and Constitutive Synthesis and
Repression 463
The Repressor 464
The Operator Region 464
The Promoter Region 465
The Operon Model of Transcriptional
Regulation 465
Positive Regulation of the Lactose
Operon 468
11-3 Regulation of the Tryptophan Operon 471
Attenultion—473
11-4 Regulation in Bacteriophage A 476
11-5 Regulation in Eukaryotes 479
Differences in Genetic Organization of Prokaryotes
and Eukaryotes 480
11-6 Alteration of DNA 480
Gene Dosage and Gene Amplification 480
Programmed DNA Rearrangements 481
Antibodies and Antibody Variability 483
Gene Splicing in the Origin of T-Cell Receptors 487
DNA Methylation 487
11-7 Transcriptional Regulation in Eukaryotes 488
Galactose Metabolism in Yeast 488
Yeast Mating Type 490
Transcriptional Activator Proteins 491
Hormonal Regulation 493
Transcriptional Enhancers 494
The Logic of Combinatorial Control 499
Enhancer-Trap Mutagenesis 499
Alternative Promoters 500
11-8 Alternative Splicing 501
11-9 Translational Control 503
UUUUUCUUCGCAUUCUUUUUUACCUUC
Phe Phe Phe Ala Phe Phe Phe Thr Phe
CHAPTERENDMATERIAL
Chapter Summary 504
Key Terms 505
Review the Basics 506
Guide to Problem Solving 506
Analysis and Applications 508
Challenge Problems 509
Further Reading 509
SPECIALFEATURES
CONNECTION: Operator? Operator? 467
Franqois Jacob, David Perrin, Carmen Sanchez,
and Jacques Monod 1960
The operon: A group of genes whose expression is coordinated
by an operator
CONNECTION: Sex-Change Operations 484
James B Hicks, Jeffrey N Strathern and Ira
Herskowitz 1977
The cassette model of mating-type interconversion
GeNETics on the web 506
11-10 Is There a General Principle of Regulation? 504
Contents ix
CHAPTER12
The Genetic Control of Development 510
12-1 Genetic Determinants of Development 513
12-2 Early Embryonic Development in Animals 514
Autonomous Development and Intercellular Signaling 514
Early Development and Activation of the Zygote
Genome 518
Composition and Organization of Oocytes 518
12-3 Genetic Control of Cell Lineages 519
Genetic Analysis of Development in the Nematode 520
Mutations That Affect Cell Lineages 522
Types of Lineage Mutations 522
The tin-12 Developmental-Control Gene 526
12-4 Development in Drosophila 529
Maternal-Effect Genes and Zygotic Genes 532
Genetic Basis of Pattern Formation in Early Development 532
Coordinate Genes 534 • Gap Genes 538
Pair-Rule Genes 538 • Segment-Polarity Genes 538
Homeotic Genes 540
12-5 Genetic Control of Development in Higher Plants 543
Flower Development in Arabidopsis 545
Combinatorial Determination of the Floral Organs 545
CHAPTERENDMATERIAL
Chapter Summary 548
Key Terms 550
Review the Basics 550
Guide to Problem Solving 550
Analysis and Applications 551
Challenge Problems 552
Further Reading 552
SPECIALFEATURES
CONNECTION: Distinguished Lineages 521
John E Sulsion, E Schierenberg J G White, and
J N Thomson 1983
The embryonic cell lineage of the nematode
Caenorhabditis elegans
CONNECTION: Embryo Genesis 535
Christiane N iisslein-Volhard and Eric Wieschaus 1980
Mutations affecting segment number and polarity in Drosophila
GeNETics on the web 552
CHAPTER13
Mutation, DNA Repair, and Recombination 554
13-1 General Properties of Mutations 556
13-2 The Molecular Basis of Mutation 557
Base Substitutions 557
Insertions and Deletions 558
Transposable-Element Mutagenesis 559
13-3 Spontaneous Mutations 561
The Nonadaptive Nature of Mutation 561
Measurement of Mutation Rates 563
Hot Spots of Mutation 565
13-4 Induced Mutations 566
Base-Analog Mutagens 567
Chemical Agents That Modify DNA 569
Misalignment Mutagenesis 571
Ultraviolet Irradiation 571
Ionizing Radiation 572
Genetic Effects of the Chernobyl Nuclear Accident 575
13-5 Mechanisms of DNA Repair 577
Mismatch Repair 578 • Photoreactivation 580
Excision Repair 581 • Postreplication Repair 582
The SOS Repair System 582
13-6 Reverse Mutations and Suppressor Mutations 583
Intragenic Suppression 583
Intergenic Suppression 585
Reversion as a Means of Detecting Mutagens, Carcinogens 585
13-7 Recombination 586
The Holliday Model 587
Asymmetrical Single-Strand Break Model 590
Double-Strand Break Model 590
x Contents
CHAPTERENDMATERIAL
Chapter Summary 593
Key Terms 594
Review the Basics 594
Guide to Problem Solving 594
Analysis and Applications 596
Challenge Problems 597
Further Reading 597
SPECIALFEATURES
CONNECTION: X-RayDaze 574
Hermann J Muller 1927
Artificial transmutation of the gene
CONNECTION: Replication Slippage in Unstable
Repeats 579
Micheline Strand Tomas A Prolla R Michael Liskay, and
Thomas D Petes 1993
Destabilization of tracts of simple repetitive DNA in yeast by muta
tions affecting DNA mismatch repair
GeNETics on the web 595
CHAPTER14
Extranuclear Inheritance 598
1m
14-1 Recognition of Extranuclear Inheritance 600
Mitochondrial Genetic Diseases 601
Heteroplasmy 602
Maternal Inheritance and Maternal
Effects 603
14-2 Organelle Heredity 604
RNA Editing 605
The Genetic Codes of Organelles 605
Leaf Variegation in Four-O clock Plants 606
Drug Resistance in Chlamydomonas 609
Respiration-Defective Mitochondrial
Mutants 610
Cytoplasmic Male Sterility in Plants 612
14-3 The Evolutionary Origin of Organelles 613
14-4 The Cytoplasmic Transmission of
Symbionts 614
14-5 Maternal Effect in Snail-Shell Coiling 617
14-6 In Search of Mitochondrial Eve 618
CHAPTERENDMATERIAL
Chapter Summary 621
Key Terms 622
Review the Basics 622
Guide to Problem Solving 623
Analysis and Applications 623
Challenge Problems 625
Further Reading 625
SPECIALFEATURES
CONNECTION: Chlamydomonas Moment 608
Ruth Sagerand Zenta Ramanis 1965
Recombination of nonchromosomalgenes in Chlamydomonas
CONNECTION: A Coming Together 619
Lynn Margulis (formerly Lynn Sagan) 1967
The origin of mitosing cells
GeNETics on the web 624
CHAPTER15
Population Genetics and Evolution 626
15-1 Allele Frequencies and Genotype Frequencies 628
Allele Frequency Calculations 628
Enzyme Polymorphisms 629
DNA Polymorphisms 630
15-2 Systems of Mating 632
Random Mating and the Hardy-Weinberg Principle 634
Implications of the Hardy-Weinberg Principle 635
A Test for Random Mating 635
Frequency of Heterozygoses 637
Multiple Alleles 638
X-linked Genes 639
15-3 DNA Typing and Population Substructure 639
Differences Among Populations 642
DNA Exclusions 644
15-4 Inbreeding 645
The Inbreeding Coefficient 646
Allelic Identity by Descent 646
Calculation of the Inbreeding Coefficient from Pedigrees 647
Effects of Inbreeding 649
15-5 Genetics and Evolution 649
15-6 Mutation and Migration 650
Irreversible Mutation 650
Reversible Mutation 652
15-7 Natural Selection 652
Selection in a Laboratory Experiment 652
Selection in Diploids 654
Components of Fitness 654
Selection-Mutation Balance 655
Heterozygote Superiority 656
15-8 Random Genetic Drift 658
CHAPTERENDMATERIAL
Chapter Summary 661
Key Terms 662
Review the Basics 662
Guide to Problem Solving 664
Analysis and Applications 664
Challenge Problems 666
Further Reading 667
SPECIALFEATURES
CONNECTION: A Yule Message from Dr Hardy 636
Godfrey H Hardy 1908
Mendelian proportions in a mixed population
CONNECTION: Be Ye Son or Nephew? 641
Alec J Jeffreys John F Y Brookfield, and Robert
Semeonoff 1985
Positive identification of an immigration test-case using human
DNA fingerprints
GeNETics on the web 663
Contents x
CHAPTER16
Quantitative Genetics and Multifactorial Inheritance 668
16-1
16-2
16-3
16-4
16-5
16-6
16-7
Quantitative Inheritance 670
Continuous, Meristic, and Threshold Traits 671
Distributions 671
Causes of Variation 675
Genotypic Variance 676
Environmental Variance 677
Genotype-Environment Interaction and Genotype-Environment
Association 678
Analysis of Quantitative Traits 680
The Number of Genes Affecting a Quantitative Trait 681
Broad-Sense Heritability 682
Twin Studies 682
Artificial Selection 683
Narrow-Sense Heritability 684
Phenotypic Change with Selection: A Prediction Equation 684
Long-Term Artificial Selection 686
Inbreeding Depression and Heterosis 687
Correlation Between Relatives 687
Covariance and Correlation 688
The Geometrical Meaning of a Correlation 688
Estimation of Narrow-Sense Heritability 689
Heritabilities of Threshold Traits 690
Linkage Analysis of Quantitative-Trait Loci 692
CHAPTER17
Genetics of Biorhythms and Behavior 702
17-1 Chemotaxis in Bacteria 704
Mutations Affecting Chemotaxis 7 06
The Cellular Components of Chemotaxis 709
Molecular Mechanisms in Chemotaxis 710
Sensory Adaptation 713
17-2 Animal Behavior 714
Circadian Rhythms 714
Love-Song Rhythms in Drosophila 716
Molecular Genetics of the Drosophila Clock 720
The Mammalian Clock, Prion Protein, and
Mad Cow Disease 723
17-3 Learning 724
Artificial Selection for Learning Ability 724
Genotype-Environment Interaction 726
17-4 Genetic Differences in Human Behavior 727
Sensory Perceptions 729
Severe Mental Disorders 730
Genetics and Personality 731
Genetic and Cultural Effects in Human Behavior 734
CHAPTERENDMATERIAL
Chapter Summary 695
Key Terms 696
Review the Basics 696
Guide to Problem Solving 696
Analysis and Applications 698
Challenge Problems 700
Further Reading 701
SPECIALFEATURES
CONNECTION: The Supreme Law of Unreason 674
Francis Galton 1SS9
Natural Inheritance
CONNECTION: Human Gene Map 693
Jeffrey C Murry and 26 other investigators 1994
A comprehensive human linkage map with
centimorgan density
GeNETics on the web 697
CHAPTERENDMATERIAL
Chapter Summary 735
Key Terms 736
Review the Basics 736
Guide to Problem Solving 736
Analysis and Applications 738
Challenge Problems 739
Further Reading 739
SPECIALFEATURES
CONNECTION: A Trip to the ZOO 713
Joan Fisher Box 1978
R A Fisher: The Life of a Scientist
GeNETics on the web 737
Answers to Chapter-End Problems 741
Supplementary Problems 767
Concise Dictionary of Genetics 795
Index 827
xii Contents
|
| any_adam_object | 1 |
| author | Hartl, Daniel L. Jones, Elizabeth W. |
| author_facet | Hartl, Daniel L. Jones, Elizabeth W. |
| author_role | aut aut |
| author_sort | Hartl, Daniel L. |
| author_variant | d l h dl dlh e w j ew ewj |
| building | Verbundindex |
| bvnumber | BV023776500 |
| classification_rvk | WG 1000 |
| ctrlnum | (OCoLC)611135656 (DE-599)BVBBV023776500 |
| dewey-full | 576.5 |
| dewey-hundreds | 500 - Natural sciences and mathematics |
| dewey-ones | 576 - Genetics and evolution |
| dewey-raw | 576.5 |
| dewey-search | 576.5 |
| dewey-sort | 3576.5 |
| dewey-tens | 570 - Biology |
| discipline | Biologie |
| edition | 4. ed. |
| format | Book |
| fullrecord | <?xml version="1.0" encoding="UTF-8"?><collection xmlns="http://www.loc.gov/MARC21/slim"><record><leader>01270nam a2200349zc 4500</leader><controlfield tag="001">BV023776500</controlfield><controlfield tag="003">DE-604</controlfield><controlfield tag="005">20070313000000.0</controlfield><controlfield tag="007">t</controlfield><controlfield tag="008">990715s1998 ad|| |||| 00||| eng d</controlfield><datafield tag="020" ind1=" " ind2=" "><subfield code="a">076370489X</subfield><subfield code="9">0-7637-0489-X</subfield></datafield><datafield tag="035" ind1=" " ind2=" "><subfield code="a">(OCoLC)611135656</subfield></datafield><datafield tag="035" ind1=" " ind2=" "><subfield code="a">(DE-599)BVBBV023776500</subfield></datafield><datafield tag="040" ind1=" " ind2=" "><subfield code="a">DE-604</subfield><subfield code="b">ger</subfield></datafield><datafield tag="041" ind1="0" ind2=" "><subfield code="a">eng</subfield></datafield><datafield tag="049" ind1=" " ind2=" "><subfield code="a">DE-634</subfield><subfield code="a">DE-11</subfield></datafield><datafield tag="082" ind1="0" ind2=" "><subfield code="a">576.5</subfield></datafield><datafield tag="084" ind1=" " ind2=" "><subfield code="a">WG 1000</subfield><subfield code="0">(DE-625)148483:</subfield><subfield code="2">rvk</subfield></datafield><datafield tag="100" ind1="1" ind2=" "><subfield code="a">Hartl, Daniel L.</subfield><subfield code="e">Verfasser</subfield><subfield code="4">aut</subfield></datafield><datafield tag="245" ind1="1" ind2="0"><subfield code="a">Genetics</subfield><subfield code="b">principles and analysis</subfield><subfield code="c">Daniel L. Hartl ; Elizabeth W. Jones</subfield></datafield><datafield tag="250" ind1=" " ind2=" "><subfield code="a">4. ed.</subfield></datafield><datafield tag="264" ind1=" " ind2="1"><subfield code="a">Sudbury, Mass. [u.a.]</subfield><subfield code="b">Jones and Bartlett</subfield><subfield code="c">1998</subfield></datafield><datafield tag="300" ind1=" " ind2=" "><subfield code="a">XXIII, 840 S.</subfield><subfield code="b">Ill., graph. Darst.</subfield></datafield><datafield tag="336" ind1=" " ind2=" "><subfield code="b">txt</subfield><subfield code="2">rdacontent</subfield></datafield><datafield tag="337" ind1=" " ind2=" "><subfield code="b">n</subfield><subfield code="2">rdamedia</subfield></datafield><datafield tag="338" ind1=" " ind2=" "><subfield code="b">nc</subfield><subfield code="2">rdacarrier</subfield></datafield><datafield tag="650" ind1="0" ind2="7"><subfield code="a">Genetik</subfield><subfield code="0">(DE-588)4071711-2</subfield><subfield code="2">gnd</subfield><subfield code="9">rswk-swf</subfield></datafield><datafield tag="689" ind1="0" ind2="0"><subfield code="a">Genetik</subfield><subfield code="0">(DE-588)4071711-2</subfield><subfield code="D">s</subfield></datafield><datafield tag="689" ind1="0" ind2=" "><subfield code="5">DE-604</subfield></datafield><datafield tag="700" ind1="1" ind2=" "><subfield code="a">Jones, Elizabeth W.</subfield><subfield code="e">Verfasser</subfield><subfield code="4">aut</subfield></datafield><datafield tag="856" ind1="4" ind2="2"><subfield code="m">HEBIS Datenaustausch</subfield><subfield code="q">application/pdf</subfield><subfield code="u">http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&local_base=BVB01&doc_number=017418714&sequence=000002&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA</subfield><subfield code="3">Inhaltsverzeichnis</subfield></datafield><datafield tag="999" ind1=" " ind2=" "><subfield code="a">oai:aleph.bib-bvb.de:BVB01-017418714</subfield></datafield></record></collection> |
| id | DE-604.BV023776500 |
| illustrated | Illustrated |
| indexdate | 2024-07-09T21:36:35Z |
| institution | BVB |
| isbn | 076370489X |
| language | English |
| oai_aleph_id | oai:aleph.bib-bvb.de:BVB01-017418714 |
| oclc_num | 611135656 |
| open_access_boolean | |
| owner | DE-634 DE-11 |
| owner_facet | DE-634 DE-11 |
| physical | XXIII, 840 S. Ill., graph. Darst. |
| publishDate | 1998 |
| publishDateSearch | 1998 |
| publishDateSort | 1998 |
| publisher | Jones and Bartlett |
| record_format | marc |
| spelling | Hartl, Daniel L. Verfasser aut Genetics principles and analysis Daniel L. Hartl ; Elizabeth W. Jones 4. ed. Sudbury, Mass. [u.a.] Jones and Bartlett 1998 XXIII, 840 S. Ill., graph. Darst. txt rdacontent n rdamedia nc rdacarrier Genetik (DE-588)4071711-2 gnd rswk-swf Genetik (DE-588)4071711-2 s DE-604 Jones, Elizabeth W. Verfasser aut HEBIS Datenaustausch application/pdf http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&local_base=BVB01&doc_number=017418714&sequence=000002&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA Inhaltsverzeichnis |
| spellingShingle | Hartl, Daniel L. Jones, Elizabeth W. Genetics principles and analysis Genetik (DE-588)4071711-2 gnd |
| subject_GND | (DE-588)4071711-2 |
| title | Genetics principles and analysis |
| title_auth | Genetics principles and analysis |
| title_exact_search | Genetics principles and analysis |
| title_full | Genetics principles and analysis Daniel L. Hartl ; Elizabeth W. Jones |
| title_fullStr | Genetics principles and analysis Daniel L. Hartl ; Elizabeth W. Jones |
| title_full_unstemmed | Genetics principles and analysis Daniel L. Hartl ; Elizabeth W. Jones |
| title_short | Genetics |
| title_sort | genetics principles and analysis |
| title_sub | principles and analysis |
| topic | Genetik (DE-588)4071711-2 gnd |
| topic_facet | Genetik |
| url | http://bvbr.bib-bvb.de:8991/F?func=service&doc_library=BVB01&local_base=BVB01&doc_number=017418714&sequence=000002&line_number=0001&func_code=DB_RECORDS&service_type=MEDIA |
| work_keys_str_mv | AT hartldaniell geneticsprinciplesandanalysis AT joneselizabethw geneticsprinciplesandanalysis |